DNA resources:

Aside from the initial dissection all the protocols below are either non-destructive or destructive. Non-destructive means that exoskeleton of a beetle or its dissected body part stays intact and can be preserved after DNA extraction. Destructive protocols require crushing external skeleton and complete loss of a respective specimen or body part after DNA extraction. 

Optimal extraction method depends on the storage, size and age of the specimen, and whether or not the exoskeleton must be preserved (non-destructive extraction): 
  • For large fresh specimens (body length > 1 cm) stored in alcohol, a hind leg with the coxa, or equivalent amount of tissue is enough.
  • For smaller, old or dry specimens use the terminal segments of abdomen with aedeagus or the whole specimen (in case of non-destructive extraction). 
    • When you use the whole specimen, remember that you probably won't be able to do a second extraction. So when putting it back in the collection be sure to add a label with DNA extracted. So people in the future would not try to extract DNA from the same specimen again.
It is advisable to do the dissection of smaller specimens at the museum, because they have no scopes at the DNA lab and bad forceps. Use clean equipment for dissection to avoid contamination, e.g. 5% bleach and 70% alcohol to clean area and equipment before dissection.

Diluting
Concentration(start) x Volume(start) = Concentration(final) x Volume(final) abbreviated as: C1V1 = C2V2, e.g. C2*V2/C1=V1 volume from stock solution. For example, you have a stock solution of 1 M CaCl2. You want to make a 10mL 3mM CaCl2 dilution:
C11 M    C= 3mM = 0.003 M    V2 = 10 mL    0.003 M * 10 mL / 1 M = 0.03 mL = 30 µL of stock solution, 10mL - 0.03mL = 9.97 mL of H2O
This means you need to transfer 30 µL of the 1 M CaCl2 stock solution to 9.97 mL of H2O to end up with a 10mL 3mM CaCl2.
If you are bad at units, you can use www.wolframalpha.com.

Making a solution from a solid
If your making a solution from a solid: C = m/V * 1/MW. m is the mass of solute in grams (g). V is the volume in liters (L) and MW is the molecular weight in g/mol. You can google MW for your particular reagent or it'll be written on the container. For example, I want to make 8 mL of dithiotreitol (DTT) 0.4 M and found out by googling that it has a MW = 154.253 g/mol. Isolate m then the formula looks like this: m = C/(1/MW) * V. Put in the numbers; 
0.4 M / (1/154.253g/mol) * 8 mL = 0.494 g. Use the weight in the lab to measure out 0.494 g of DTT, then add it to a tube and add 8 mL of H2O. You could also do it the other way around, measuring out the amount and then calculating how much water you'll need to add.

Good for fresh specimens in alcohol. Easy to use and fast, requires no premixing of chemicals. Low yields from older specimens and small specimens, if you do non-destructive extraction. Doing destructive extraction (destroying the specimens with a pestel or the TissueLyser II) increases the yield.
Instead of vortexing, you can mix the solution in the sample tubes by inverting the sample tube rack a few times, use an empty rack as counterpart so your tubes do not fall down. 
  1. Carefully remove beetle parts on a clean tissue or petri dish and avoid contaminations (use pins or forceps).
  2. Put each beetle part (or a whole specimen when the whole body is used) into a new 1.5mL eppendorf.
    • If a specimen comes from alcohol, transfer the tube into a heater for 10-15 min at 50°C, to let the EtOH evaporate .
  3. Premix 180µL of ATL buffer with 20µL of Proteinase K for each sample tube.
    • Remember always to mix a bit more than you will use, e.g. for 9 samples prepare as for 10 samples. This would be 1800µL ATL buffer mixed with 200µL of Proteinase K. 
  4. Pipette 200µL of the mix into each sample tube and vortex for 10 sec.
  5. Incubate in oven overnight at 56°C.
    • Put it in the spinner or prolong the incubation time to increase yield a bit.
  6. Premix 200µL AL buffer and 200µL EtOH 96% for each sample and vortex the mixture.
  7. Pipette a total volume of 400µL of this mix into every sample tube and vortex.
  8. Incubate at 56°C for 10-15 min while vortexing 2-3 times.
  9. Pipet the mixture into the DNeasy Mini spin columns placed in a 1.5mL collection tube.
    • Remember to label the spin columns, not the collection tubes.
  10. Centrifuge at 8000rpm for 1min. Discard flow-through and dry rim of collection tube in paper towel.
  11. Add 500 µL of AW1 buffer, and centrifuge at 8000rpm for 1min. Discard flow-through and dry rim of collection tube.
  12. Add 500 µL of AW2 buffer, and centrifuge at 8000rpm for 1min. Discard flow-through and dry rim of collection tube.
  13. Centrifuge at 14000rpm for 3min. Discard flow-through and collection tube. Place the DNeasy Mini spin column in a clean 1.5mL eppendorf tube.
  14. Add 30 to 200 µL of AE buffer directly onto the spin column membrane.
    • The needed amount of AE buffer depends on the needed DNA concentration. If you need higher DNA concentration add less AE buffer.
  15. Incubate at 37°C for 15min. Centrifuge at 14000rpm for 1min.
    • Can be done in the green lab.
    • To maximize the yield of DNA the last 2 steps can be repeated into a new 1.5mL sample tube, this way you get 2 extracts, the second with a lower concentration.
After the extraction process, store the samples in labeled boxes in the -20°C freezer, in order to avoid fast defragmentation of the DNA.

Good for old, dry or small specimens. Requires premixing, harder to use and slower but gives higher yields, from Gilbert et al. (2007) and Thomsen et al. (2009). Remember to use clean equipment for dissection to avoid contamination. Use 5% bleach and 70% alcohol to clean area and equipment before dissection. 

The digestion buffer without added proteinase K, can be used to to soften dry specimens. Leave the specimen in the buffer for > 1 hour, then dissect the specimen. After dissection remove the part of the specimens not for extraction and put it in 96 % for 2-4 hours to remove the buffer. Take the part for extraction and the buffer used for dissection, to the lab and do the extraction. Remember to add proteinase K.

Digestion buffer modified from Pfeiffer et al. (2004):           Stock solution:               Location:
  1. 3 mM CaCl2                 1 M                         Yellow lab, drawer 3 or drawer 1 (solid).
  2. 2% sodium dodecyl sulphate (SDS)                                10%                       Yellow lab, drawer 4.
  3. 40 mM dithiotreitol (DTT)                  0.4 M                     Yellow lab, drawer 2 (solid).
  4. 100 mM Tris buffer pH 8 :                1 M                         Yellow lab, fridge.
    • Tris Tris(hydroxymethyl)aminomethane
    • HCl (to adjust pH)
  5. 100 mM NaCl (Sodium chloride)                1 M                        Yellow lab, drawer 2 (solid).
  6. 250 µg/mL proteinase K                  20mg/mL               Yellow lab, fridge or part of DNEasykit.
Isopropanol precipitation extraction
  1. 20 µg glycogen (or 5 µL glycblue, Ambion)    -                           Yellow lab, fridge.
  2. 0.6 volumes 100% isopropanol            -                           Yellow lab, drawer 3.
  3. 0.1 volumes 3M Sodium acetate pH 5.2 :            -                           Yellow lab, drawer 3 .
    •   (Natriumacetate 3M pH 5.2)
  4. 85 % Ethanol, ice-cold.                                                     96%                      Yellow lab.
Extraction protocol
  1. Gather the chemicals and mix the digestion buffer. Store all the chemicals in the fridge, so they are ready for the extraction.
    • To prepare 10 ml of buffer from the stock solutions add:
      1. 30 µL      CaCl2 from 1 M stock solution.
      2. 2000 µL  SDS
      3. 1000 µL  DTT
      4. 1000 µL  Tris buffer pH 8
      5. 1000 µL  NaCl
      6. 125 µL    proteinase K
      7. 4845 µl   H2O
  2. If the specimen is in alcohol, transfer it to a 1.5mL Eppendorf tube and dry it for 10 min at 56°C in the heatblock, to evaporate the alcohol.
  3. Put specimen in 1.5mL Eppendorf tubes, so it is fully immersed in digestion buffer (volume dependent on specimen size, e.g. 200 µL).
  4. Incubate at 56°C with gentle agitation for 16–20 hours.
  5. Remove specimen from the buffer and put it in 100% EtOH for 2–4 hours to stop further digestion.
  6. Air-dry, and put your specimen back in the collection.
  7. Add 5 µL glycoblue, Ambion (or 20 µg glycogen), 0.6 volumes 100% isopropanol and 0.1 volumes 3M Sodium acetate pH 5.2.
    • e.g. with 200 µL of buffer, add 
    • 5 µL glycoblue, 
    • 120 µL 100% isopropanol and 
    • 20 µL 3M Sodium acetate pH 5.2.
  8. Immediately but gently vortex the mixture.
  9. Centrifuged at room temperature at maximum speed for 25 minutes to pellet the nucleic acids.
  10. Remove the liquid and wash the pellet twice in 1.5 mL ice-cold 85% ethanol, allow to air-dry at 65°C, and resuspend in 100 µL molecular biology grade H2O or TE buffer(for long time storage).
After the extraction process, store samples in labeled boxes in the -20°C freezer, in order to avoid fast defragmentation of the DNA.

We use AmpliTaq Gold (Thermofisher).


PCR protocol (AmpliTaq Gold) based on Brunke et al. (2015).
For nested PCR, use 1 µL of product from the first PCR as template for the next PCR.
It is a good idea to include a negative and positive control when doing PCR, e.g. a blank sample without any template and a sample with a template that you know works. This makes troubleshooting the PCR afterwards much easier.
For difficult amplifications you can add 1µL of BSA (bovine serum albumin). It makes the DNA more accessible to the enzymes for amplification and it also prevents adhesion of enzymes to the reaction tubes and tip surfaces.

 Component  Volume pr. reaction (µL) Concentraction in Mastermix  Adjustments
 Distilled water  13.3  -  
 10X PCR Gold Buffer  2.5  1X  
 25 mM MgCl2  2.5  2.5 mM  1-4 mM
 10 mM dNTP  2  0.8 mM  
 10 µM Primer F  1.25  0.5 µM  0.2-1 µM
 10 µM Primer R  1.25  0.5 µM  0.2-1 µM
 5U/µL AmpliTaq Gold  0.2  1 U  max 2 U
 Template DNA 2  *  *
 Total Volume  25    
  1. Prepare the mastermix for the selected gene of interest. *Adjust the template and water volume according to the DNA concentration of your extract. For low concentrations, <10 ng/µL, use more template. The following formula refers to one sample, so for multiple samples the corresponding volumes need to be multiplied accordingly. It may be wise to count additional samples, in order to have a residual volume of mastermix, just in case. (e.g. for 25 samples, multiply the following values with 26). The mastermix consists of the following:
    • *13.3 µL   distilled water
    • 2.5 µL     10X PCR Gold Buffer
    • 2.5 µL     25mM MgCl2
    • 2 µL        10mM dNTPs
    • 1.25 µL   10µM F primer
    • 1.25 µL   10µM R primer
    • 0.2 µL     5U/µL AmpliTaq Gold
    • *2 µL       Template DNA, add later in the Green lab.
    • 25 µL      Total volume
  2. Mix the mastermix thoroughly by inverting the tube.
  3. Centrifuge the mastermix at 500rpm for 10s.
  4. Pipette 23µL of the mastermix into a well of a 96-well plate or a 200µL tube of an eight-stripe strip.
  5. Add 2µL of your sample DNA into the corresponding well or tube.
  6. Close the tubes or the 96-well plate (the correct closure is important in order to avoid evaporation of the mastermix during the PCR).
  7. Transfer the samples into the PCR-machine and start the correct amplification profile program (list below) in order to initiate the PCR.


Some amplifications profiles, e.g. TP (Nested PCR 1) TP675F + TP919R, have cycles with two different extension times:
1’ 94°C – 7x (45s 94°C – 45s 59°C – 35’ 72°C) – 27x (45s 94°C – 45s 59°C – 1.5’ 72°C) – 5’ 72°C
This is done to avoid the presence of multiple bands, see Wild & Maddison (2008).

  • COI (C1-J-2183 + L2-N-3014) Pat + Jerry. Chatzimanolis et al. (2010)
5’94°C – 35x (45s 94°C – 30s 45°C – 1’72°C) – 2’ 72°C

1’94°C – 5x (30s 94°C – 40s 47°C – 1’72°C) – 30x (30s 94°C – 40s 52°C – 1’72°C) – 7’ 72°C

5’94°C - 5x (30s 94°C - 30s48°C - 1’72°C) - 30x (30s 94°C - 30s52°C - 1’72°C) - 7’72°C

  • 28S (NFL184-21 + LS1041R). Chatzimanolis et al. (2010)
2’94°C - 35x (45s94°C - 30s50-58°C - 1’72°C) - 2’72°C
Increase temperature with 0.2°C every cycle to go from 50 to 57°C.
For difficult amplifications of 28S, add 1.25 µL of DMSO (dimethylsulphoxide) as per Brunke et al. 2015.
3’ 94°C – 35x (30s 94°C – 30s 50°C – 1’ 72°C) – 10’ 72°C

  • Wg (Nested PCR) Chatzimanolis et al. (2010)
  • Wg550F + WgABRZ
1’ 94°C – 35x (30s 94°C – 30s 59°C – 3' 72°C) – 5’ 72°C
  • Then take 1 µL of product and do PCR with:
  • Wg578F + WgABR
1’ 94°C – 35x (30s 94°C – 30s 59°C – 1’ 72°C) – 5’ 72°C

  • TP (Nested PCR 1) Chatzimanolis et al. (2010)
  • TP643F + TP932R
1’ 94°C – 35x (45s 94°C – 45s 59°C – 3’ 72°C) – 5’ 72°C
  • Then take 1 µL of product and do PCR with:
  • TP675F + TP919R 
1’ 94°C – 7x (45s 94°C – 45s 59°C – 35s 72°C) – 27x (45s 94°C – 45s 59°C – 1.5’ 72°C) – 5’ 72°C

  • TP (Nested PCR 2) Chatzimanolis et al. (2010)
  • TP643F + TP932R
1’ 94°C – 35x (45s 94°C – 45s 59°C – 3’ 72°C) – 5’ 72°C
  • Then take 1 µL of product and do PCR with:
  • TP675F + TP932R
1’ 94°C – 7x (45s 94°C – 45s 59°C – 35s 72°C) – 27x (45s 94°C – 45s 59°C – 1.5’ 72°C) – 5’ 72°C

  • ArgK (Nested PCR) Chatzimanolis et al. (2014)
  • Optimal Tm varies from 55°C to 60°C.
  • AK168F + AK939R
2’ 94°C – 35x (30s 94°C – 30s 55°C – 1’ 72°C) – 2’ 72°C
  • Then take 1 µL of product and do PCR with:
  • AK183F + AK939R
2’ 94°C – 35x (30s 94°C – 30s 55°C – 1’ 72°C) – 2’ 72°C

  • CADA (Nested PCR) Chatzimanolis et al. (2014)
  • Both CADA and CADC use the same first external primers and amplification profile.
  • CD439F + CD1098R
1’ 94°C – 35x (45s 94°C – 45s 55°C – 3’ 72°C) – 5’ 72°C
  • Then take 1 µL of product and do PCR with:
  • CD439F + CD688R
1’ 94°C – 7x (45s 94°C – 45s 52°C – 35s 72°C)  – 27x (45s 94°C – 45s 52°C – 1.5' 72°C)  – 2’ 72°C

  • CADC (Nested PCR) Chatzimanolis et al. (2014)
  • CD439F + CD1098R
1’ 94°C – 35x (45s 94°C – 45s 55°C – 3’ 72°C) – 5’ 72°C
  • Then take 1 µL of product and do PCR with:
  • CD821F + CD1098R
1’ 94°C – 7x (45s 94°C – 45s 52°C – 35s 72°C)  – 27x (45s 94°C – 45s 52°C – 1.5' 72°C)  – 2’ 72°C

Alternative profiles for CADA and CADC from Brunke et al. (2015)
  • CADA (CD439F + CD688R) Brunke et al. (2015)
2’ 94°C – 35x (1'94°C – 30s 56°C – 2’ 72°C) – 10’ 72°C
In most cases, it was necessary to use 1 µL of this PCR product in a repeated reaction to produce adequate concentrations of final product for sequencing.

  • CADC (Nested PCR) Brunke et al. (2015)
  • CD439F + CD1098R
3’ 94°C – 10x (30s 94°C – 30s 57°C – 1.5' 72°C)  – 10x (30s 94°C – 30s 55°C – 1.5' 72°C)  – 20x (30s 94°C – 30s 45°C – 1.5' 72°C)  – 10’ 72°C
  • Then take 1 µL of product and do PCR with:
  • CD821F + CD1098R
3’ 94°C – 10x (30s 94°C – 30s 57°C – 1.5' 72°C)  – 10x (30s 94°C – 30s 55°C – 1.5' 72°C)  – 20x (30s 94°C – 30s 45°C – 1.5' 72°C)  – 10’ 72°C



To check if the PCR worked and brought correct DNA products, we run gel-electrophoresis. If there is no more Agarose, see the recipes book at the Gel area and make some more. 
  1. Prepare a casting box with the adequate number of combs, to have enough gel pockets for all you samples.
  2. Pour 2 % Agarose into the box and wait at least 30 min for it to solidify. 
    • Be sure to remove air bubbles from the gel and the gel pockets.
  3. Transfer the gel into the gel electrophoresis chamber.
    • Make sure to remove air bubbles, and that the electrophoresis chamber is filled with enough TAE buffer.
  4.  Pipette 2 µL of 100 bp DNA ladder into the first gel pocket.
  5. Take a strip of Parafilm and 2 µL of loading buffer for each sample, and pipette the buffer on to the Parafilm.
    • Use a multi pipette and the no filter tips, this way you can do 8 samples at once. The loading buffer is in the fridge.
  6. Add 3 µL of sample to the droplet of loading buffer on the Parafilm, then change your pipette to 5 µL and pipette the droplet into a gel pocket.
    • Remember to use filter tips for this step. If your are confident in your multi pipetting skills, you can use the multi pipette. Maybe start up with 4 samples at once, to get a hang of it.
  7. Run the gel at 130 V for 35 min, until the dye line is approximately 75-80% of the way down the gel.
  8. Turn off the power, disconnect the electrodes. Remove the gel carefully, and put it in the UV chamber.
  9. Adjust the camera, close the door and turn on the UV. Take a photo.
    • You can write directly onto your photo which samples are in the different gel pockets.


We order primers from tagc.dkThere are three different purification levels, when ordering primers: Desalted, RPC and HPLC. For normal PCR 0.04µmol desalted primers are sufficient. 

 Gene  Bps  Amplification  Primer  Sequence (5'-3')  Reference
 28S  678-  NFL184-21 + LS1041R  NFL184-21  ACCCGCTGAAYTTAAGCATAT  Van der Auwera et al. (1994)
  1244  1.25μl DMSO or 5μl Q  solution for difficult taxa  LS1041R  TACGGACRTCCATCAGGGTTTCCCCTGACTTC  Maddison (2008)
 COI  798  C1-J-2183 + L2-N-3014  C1-J-2183  CAACATTTATTTTGATTTTTTGG  Simon et al. (1994)
     Jerry + pat  L2-N-3014  TCCAATGCACTAATCTGCCATATTA  Simon et al. (1994)
     LCO1490 + HCO2198  LCO1490  GGTCAACAAATCATA AAGATATTGG  Folmer et al. (1994)
     Folmer  HCO2198  TAAACTTCAGGGTGACCAAAAAATCA  Folmer et al. (1994)
           
 Wg  364-  Nested PCR:  Wg550F  ATGCGTCAGGARTGYAARTGYCAYGGYATGTC  Wild and Maddison (2008)
   396  Wg550F + WgABRZ, then  WgABRZ  CACTTNACYTCRCARCACCARTG  Wild and Maddison (2008)
     Wg578F + WgABR  Wg578F  TGCACNGTGAARACYTGCTGGATG  Ward and Downie (2005)
       WgABR  ACYTCGCAGCACCARTGGAA  Abouheif and Wray (2002)
           
 TP  718-  Nested PCR:  TP643F  GACGATTGGAARTCNAARGARATG  Wild and Maddison (2008)
   726  TP643F + TP932R, then  TP932R  GGWCCDGCATCDATDGCCCA  Wild and Maddison (2008)
     TP675F + TP919R or,  TP675F  GAGGACCAAGCNGAYACNGTDGGTTGTTG  Wild and Maddison (2008)
     TP675F + TP932R  TP919R  GTCTCTTTGCGTYTTRTTRTADATYTTYTC  Wild and Maddison (2008)
           
 ArgK  723  Nested PCR:  AK168F  CAGGTTTGGARAAYCACGAYTCYGG  Wild and Maddison (2008)
     AK168F + AK939R, then  AK939R  GCCNCCYTCRGCYTCRGTGTGYTC  Wild and Maddison (2008)
    AK183F + AK939R   AK183F  GATTCTGGAGTCGGNATYTAYGCNCCYGAYGC  Wild and Maddison (2008)
           
 CAD  620  For CADA:  CD439F  TTCAGTGTACARTTYCAYCCHGARCAYAC  Wild and Maddison (2008)
     CD439F + CD688R or,  CD1098R  GCTATGTTGTTNGGNAGYTGDCCNCCCAT  Wild and Maddison (2008)
     Nested PCR –  CD688R  TGTATACCTAGAGGATCDACRTTYTCCATRTTRCA  Wild and Maddison (2008)
     CD439F + CD1098R, then  CD821F  AGCACGAAAATHGGNAGYTCNATGAARAG  Wild and Maddison (2008)
     CD439F + CD688R      
           
   640  For CADC:      
     Nested PCR –      
     CD439F + CD1098R, then      
     CD821F + CD1098R      



There is a good guide to troubleshooting the PCR here: http://www.bio-rad.com/en-dk/applications-technologies/pcr-troubleshooting


Abouheif, E., Wray, G. A. 2002. Evolution of the gene network underlying wing polyphenism in ants. Science 297, 249-252.

Brunke, A.J., Chatzimanolis, S., Schillhammer, H., Solodovnikov, A., 2015. Early evolution of the hyperdiverse rove beetle tribe Staphylinini (Coleoptera: Staphylinidae: Staphylininae) and a revision of its higher classification. Cladistics n/a–n/a. doi:10.1111/cla.12139

Chatzimanolis, S., Cohen, I.M., Schomann, A., Solodovnikov, A., 2010. Molecular phylogeny of the mega-diverse rove beetle tribe Staphylinini (Insecta, Coleoptera, Staphylinidae). Zool. Scr. 39, 436–449. doi:10.1111/j.1463-6409.2010.00438.x

Chatzimanolis, S., 2014. Phylogeny of xanthopygine rove beetles (Coleoptera) based on six molecular loci. Syst. Entomol. 39, 141–149. doi:10.1111/syen.12040

Folmer O, Black M, Hoeh W, Lutz R and Vrijenhoek R (1994), DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol., 3 (1994), pp. 294–299.

Gilbert, M.T.P., Moore, W., Melchior, L., Worobey, M., 2007. DNA Extraction from Dry Museum Beetles without Conferring External Morphological Damage. PLoS One 2, e272. doi:10.1371/journal.pone.0000272

Maddison, D. R. 2008. Systematics of the North American beetle subgenus Pseudoperyphus (Coleoptera: Carabidae: Bembidion) based upon morphological, chromosomal, and molecular data. Annals of the Carnigue Museum of Natural History 77, 147-193.

Pfeiffer I, Volkel I, Taubert H, Brenig B (2004) Forensic DNA-typing of dog hair: DNA-extraction and PCR amplification. Forensic Sci Int. 141: 149–151.

Simon, C., Frati, F., Reckenbach, A., Crespi, B., Liu, H., Flook, P. 1994. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651-701.

Thomsen, P.F., Elias, S., Gilbert, M.T.P., Haile, J., Munch, K., Kuzmina, S., Froese, D.G., Sher, A., Holdaway, R.N., Willerslev, E., 2009. Non-destructive sampling of ancient insect DNA. PLoS One 4, e5048. doi:10.1371/journal.pone.0005048

Van der Auwera, G., Chapelle, S., De Wachter, R. 1994. Structure of the large ribosomal subunit DNA of Phytophthora megasperma, and phylogeny of the oomycetes. FEBS Letters 338, 133-136.

Ward, P. S., Downie, D. A. 2005. The ant subfamily Pseudomyrmecinae (Hymenoptera: Formicidae): phylogeny and evolution of big-eyed arboreal ants. Systematic Entomology 30, 310-335.

Wild, A. L., Maddison, D. R. 2008. Evaluating nuclear protein-coding genes for phylogenetic utility in beetles. Molecular Phylogenetics and Evolution 48, 877-891.

  1. Image guide
    1. Choosing and Cleaning your specimen
    2. Camera Settings
    3. Flash Settings
    4. StackShot Settings
    5. Adjusting White Balance
    6. Taking photos for photo stacking
    7. Stacking your images using ZereneStacker
  2. Leica Microscope M205C with Canon EOS 6D camera (room 421)
    1. Setting up the Camera
    2. Choosing the right light source
    3. Taking pictures
    4. Stacking pictures
    5. Measuring
  3. References

Image Guide using the camera in room 421

This is the image protocol used for taking the pictures for the billebank.dk.


It is rather time-consuming to make a focus stacked image of a specimen, so you want to make sure the image turns out as good as possible. Therefore,choose a specimen which is nicely mounted, e.g., a flat mounting showing all appendages, legs, palpi, mandibles, and antennae makes for a better picture. You should also choose a specimen, if possible, without large amounts of excess glue, dust, or grease as this can be hard to remove.

When you have chosen your preferred specimen, you should clean it. Cleaning can be done by either lightly brushing it with a fine brush using soapy water or with acetyl acetate. For the soapy water, one drop of soap should be enough for a glass of water, as too much soap has a tendency to create an unnatural iridescent coloration, if this occurs, it can be removed by using clean water afterward. Either way, the washing helps to remove any dust or grease that is still on your specimen. I can almost guarantee you that even after doing this you will still have tiny amounts of dust, but try to remove larger pieces, as these are difficult to edit out at a later stage digitally.

You now have a nice and clean specimen ready for photographing. Make sure that the specimen is dry before you start taking photos.

Use the cameras manual mode (M on the dial) and set to the following settings:

Shutter speed 1/200 sec 
Aperture f/5.6
ISO 100

Take photos in RAW-format as this will give you more editing possibilities, especially to adjust white balance at a later stage.

Canon Macro Twin Lite MT-24EX flash unit should be connected to the cameras hot shoe, with the two flash units at either side of the specimens slightly tilted forwards. The flash unit should have the following setting:

Mode ETTL
Ratio should be set see the Ratio and CH in the upper right hand corner. Ratio should be adjusted to be 1:1.
CH should be set on 4
SEL/SET should be adjusted to + 1 using the + and – buttons.

Important:
!!! If you think the lighting in the photos are too dark or bright this can and should only be adjusted using the SEL/SET button on the Canon Macro Twin Lite MT-24EX flash unit.
!!! When you change the batteries for the Canon Macro Twin Lite MT-24EX flash unit the settings will reset. It is therefore important that when doing so that you reconfigure these settings.

Canon Speedlite 430EX III-RT flash unit should be standing on the shoe foot directly in front of the specimen (shooting directly into the head of the specimen).
Mode ETTL and Lightning Slave
Ratio should be set see the Ratio and CH in the upper right hand corner. Ratio should be adjusted to be 1:1.
CH should be set on 4 and C
SEL/SET should be set to +0
3
 StackShot Settings:
The StackShot should be set to the following settings: Mode Auto-Step
# Steps 20
You can adjust # Steps dependent on the size from top to bottom of the specimen you are photographing, but for most specimen I found this to be more than enough steps.
4
 Adjusting White Balance:
White balance can be adjusted when importing the photos or when you are editing the photos. The white balance is adjusted to the flashes used and is therefore the most true recreation of colors.
3 Flash white balance
When using all three flashes (both the Canon Macro Twin Lite MT-24EX and the Canon Speedlite 430EX III-RT the white balance should be set to the following:
Temp 5800 Tint 15
2 Flash white balance
When just using the Canon Macro Twin Lite MT-24EX flashes the white balance should be set to the following:
Temp 5500 Tint 10
Create new white balance measurement
5
If you are taking photos with a different setup of lighting it might be a good idea to do a create a new white balance measurement. Aslak Kappel Hansen or Anders Illum can help you make this measurement.
Taking photos for photo stacking:
The cleaned specimen should be placed in the foam on glass plate on top of the reflective box. Two diffuser cones should then be set around the specimen, one soft diffusive paper one and one harder plastic cup diffuser.
 6
 In either case you will need to find the upper and lower bound of you specimen. This is done by either of the following methods
Use the cameras live view function, by pressing the Start/Stop button on the camera. To get the camera to adjust the exposure you need to half-press the cameras shutter button (the button you use to take photos with).
Use the Canon EOS Ultility to get live view on your computer. Once again you need to half-press the shutter button (the button you use to take photos with) to get the camera to adjust the exposure.
7
Once this is done find the upper and lower bound of your specimen. This is done by looking at the camera and using the by Up/Down toggle on the StackShot and finding the lower bound when you specimen is completely blurry. Once you found this place press the Change Start/Stop on the StackShot and press Set (Select the Start Position). Now use the Up/Down toggle to move through the focus plane of your specimen to find the upper bound (when the specimen is once again totally blurry). When this is found press Set (Select the End Position).
Now you are ready to take a photo. This is done by pressing the Camera button on the StackShot. It is a good idea to connect the camera to your computer and use the tethered function of Lightroom or Canon EOS Utility to directly import your photos. Otherwise you can always import the photos from the camera afterwards. No matter what it is important to keep track of which series of photos are taken in each capture.
Stacking your images using ZereneStacker
After you have imported your raw photo files to Lightroom or Canon EOS Utility you must export
them as .tif images, as ZereneStacker isn’t able to read the .CR2 files created by the camera. This can be done in Lightroom by using the export button.
The .tif files can be imported to ZereneStacker by dragging them into the Input Files field or by going to FilesàAdd File(s).
Once a series of images are imported you are ready to stack them. This is done by clicking the
StackàAlign and Stack All (PMax)
When the stack has completed you can save the stacked image by going to FileàSave Output
Image(s)
Digital manipulation in Photoshop
You can import your stacked photo in Photoshop to remove additional dust, crop the image, or any other change that you feel are needed.
Dust can be removed by using the Spot Healing Brush tool on the Content-Aware setting and brushing it over areas where there is excess dust.
Placing a scale bar:
Once your photo is digitally edited and cropped you can place a scale bar. To use this function it is important to know at what magnification you image was shot. Make sure to set the magnification to either 1x, 2x, 3x, 4x, or 5x. After this is done a scale bare can be added in Photoshop by using the ImageàAnalysisàSet Measurement Scale with the following settings:
Camera magnification 1x: 160 px = 1 mm Camera magnification 2x: 320 px = 1 mm
8
Camera magnification 3x: 480 px = 1 mm Camera magnification 4x: 640 px = 1 mm Camera magnification 5x: 800 px = 1 mm
After this is done press the ImageàAnalysisàPlace Scale Marker...









Before use, write the date and your name on the list of microscope users. If there are any problems with the set-up or you install new software describe it on the list. If the photo system does not work properly – ask somebody for help. Do not try to fix the problem by yourself. 
Remeber to turn everything off after use, cover the microscope up and charge the batteriesDo not remove the camera from the Microscope.
To improve the quality of the pictures you can use Adobe Lightroom or Adobe Photoshop. Do not uninstall any software!

List of the equipment: 
  • Stereomicroscope Leica M205 C
  • Leica TL5000 Ergo
  • Leica LED5000 SLI
  • Leica LED5000 NVI
  • Canon EOS 6D
  • LM digital SLR universal wide-field adapter
  • T2-adapter (upgrade module on LM digital widefield adapter
  • Leica Port 1x with 37mm tube for Leica microscopes

  1. Turn on the PC and log in to your KU account.
  2. Turn on the Leica-microscope by pressing two buttons on the back of the microscope.
  3. Connect the PC to the Canon camera using USB cable.
  4. Turn on the Canon EOS 6D camera.
    • Turn on the camera flash (optional).
    • Canon EOS Utility software starts automatically.
  5. Select “Remote Shooting”.
    • A new window will appear.
    • If you change the camera settings, be sure to change them back after use. 
    • See "Taking pictures" for more info.
  6. Choose a destination folder for your pictures.
    • Default: make a new folder on the desktop with your name.
  7. Select “Live View shoot…

Choose a destination folder













Live View shoot…




Choosing the right light source
Avoid looking directly into the LEDs. Remember to turn off the lights after use.
  • For transparent specimens try the light system at the base of the microscope.
  • For pinned insects use the lateral lightning sources.
    • To reduces glare, diffuse the light by using the white plastic domes, silver diffusers that can be screwed on or similar.
  • For recesses and holes use the top light source in the microscope.
The microscope has 3 sources of light:
  1. The base of the microscope: Flat LED Transmitted Light Base with Automatic Aperture Leica TL5000 Ergo.
  2. The lateral lightning sources: LED Spotlight Illuminator with Gooseneck Leica LED5000 SLI.
  3. The top light source in the microscope: LED vertical illuminator, Leica LED5000 NVI.

1. The base has several common positions:
  • (BF) Brightfield, light field fully open, automatic aperture inactive.
  • (BF) Brightfield, optimally illuminated light field, automatic aperture active.
  • (RC) Light field illuminated in Rottermann Contrast™ mode, light source is displaced out of the beam path.
  • (DF) Darkfield, low-reflection black background, indirect illumination.

2. The lateral lightning sources
  • To reduces glare, diffuse the light by using the white plastic domes, silver diffusers that can be screwed on or similar.
  • The flexible gooseneck allows you to move the keypad into any position desired.
  • Use the  key to switch the lights on or off.
  • Use the  or  keys to adjust the brightness in 10 increments. Tap the keys briefly to adjust the intensity in small increments. Hold one key to change the intensity more quickly.
  • Touch the  key to reach single spot mode. Press and hold to make the spotlights change automatically.

3. The top light source in the microscope
  • Turn on the illuminator before you look through the eyepieces.
  • LED vertical illuminator for is good for illuminating recesses and holes.
  • Use the  key to switch the illuminator on or off.
  • Use the  or  keys to adjust the brightness in 10 increments.


Please leave the settings in the default mode after your work. 
    1. Default mode for “Canon EOS Utility” remote shooting is “shutter speed 1’’” and
      ISO AUTO”; Image quality “L” - jpeg (5472x3648).
      • In the default mode the camera produces JPEG-file. RAW file can be converted into TIFF of JPEG in “Adobe Lightroom”.
      • To use the flash, set the shutter speed to 1/200 and ISO 100 or ISO AUTO
      • When taking pictures without flash, switch off the flash and choose shutter
        speed between 
        1/10 and 1” and ISO AUTO.
    2. To take a picture, use the black button in the Canon software.
      • You can also shoot using the <Space> bar on the keyboard.
    3. Digital Photo Professional 4” and “Quick Preview” software will open automatically.
      Both can be useful for images browsing.
    4. Use the fine focus knob, to adjust the focus, while taking multi-layered pictures.
      • The order of the images does not matter when stacking, you can both move the focus up, down or randomly.
    5. If you want to make measurements later or put in a scale bar there are several ways to do it:
      1. Remember at which magnification the picture was taken,      (for Photoshop extended)
      1. Put a scale beside the specimen when taking the picture or  (for Photoshop extended or ImageJ)
      2. Take another picture at the same magnification of an object of known length. (for Photoshop extended or ImageJ)
    Be sure that the locking button (arrow) on a magnification wheel is in the upper position
    1. Launch “Zerene Stacker” from the desktop or windows toolbar and click OK to the pop-up window.
    2. Find your pictures: a desktop folder is the default location.
    3. Drag the pictures to the upper left window in Zerene Stacker (or File: Open…)
    4. Select “Stack and sort all (PMAX)” from drop-down menu.
      • Wait patiently ;) 
    5. Click “File”: Save output image” and choose “Desktop” as destination: when finished, move your files to some other media (USB/Flash-disc).
      • If you have more pictures to combine, click “File”: “Close project” in Zerene Stacker and repeat the shooting and stacking processes.
    6. When you finish, remember to delete your files from the desktop (after copying them to your own media) to ensure there is ample disk space for other users.
    7. Log out and shut down the PC, microscope, camera and light source(s).
    8. Remove your specimen from the microscope base.
    9. Put the red dust cover on the microscope.

    Now you have you pictures and either:
    1. The magnification at which the picture was taken, (for Photoshop extended)
    2. A scale beside the specimen or  (for Photoshop extended or ImageJ)
    3. Another picture at the same magnification of an object of known length. (for Photoshop extended or ImageJ)
    There are to programs you can use for measuring. The commercial software Adobe Photoshop Extended, which is good for image editing and retouching. The free software ImageJ, used for scientific image analysis, it can do much more than just measure. 
    1. Remember at which magnification the picture was taken.
    2. If you a new user you have to copy “Measurement Scales.psp” file from the root of “Windows (C:)” disc to: “C:\Users\AAA000\AppData\Roaming\Adobe\Adobe Photoshop CS6\Adobe Photoshop CS6 Settings”. Where AAA000 is your KU username.
    3. Open Adobe Photoshop CS6
    4. Open your picture
    5. Go to Image > Analysis > Set Measurement Scale and choose your magnification
      •  
    6. Go to Image > Analysis > Place Scale Marker… A new window will appear: 
      •  
    7. Here you can change the scale options. Changing the “Length” options will change length of the measuring scale on your picture.
    8. Change the other options as you need and press “OK” button.
    9. The measuring scale will appear on the picture and you can use it as a layer.
    10. For more info, go to https://helpx.adobe.com/photoshop/using/measurement.html 

    1. Open ImageJ, it can be downloaded from here: https://imagej.nih.gov/ij/download.html
    2. Open your picture.
    3. Use the 1 Magnifying Glass and Scrolling Tool to navigate around your picture (hold ctrl to zoom out).
    4. Use the Straight Line Tool to measure out your known distance 3 (hold shift to get it straight).
    5. Go to Analyze > Set Scale...
      • Put in the Know distance, in this example 1 and Unit of length "mm".
      • If you have multiple photos taken at the same magnification
        • When Setting the scale tick the Global box and all your images would have the same scale.
    6. To put a scale bar on the picture go to Analyze > Tools > Scale Bar...
          
    7. To measure distance on your photo use the Straight Line Tool to draw the distance.
    8. Then go to Analyze > Measure and you will get the Length
      • You can change what it measured by going to Analyze > Set Measurements...
      • To save your measurements go to File > Save As > Measurements, this saves them as a tab-delimited text file.


    Leica TL5000 Ergo manual:

    ImageJ